File PDF .it

Condividi facilmente i tuoi documenti PDF con i tuoi contatti, il Web e i Social network.

Inviare un file File manager Cassetta degli attrezzi Ricerca PDF Assistenza Contattaci



post .pdf



Nome del file originale: post.pdf
Autore: Utente Windows

Questo documento in formato PDF 1.6 è stato generato da Acrobat PDFMaker 19 per Word / Adobe PDF Library 19.12.66, ed è stato inviato su file-pdf.it il 13/02/2021 alle 04:13, dall'indirizzo IP 79.52.x.x. La pagina di download del file è stata vista 349 volte.
Dimensione del file: 474 KB (11 pagine).
Privacy: file pubblico




Scarica il file PDF









Anteprima del documento


La truffa è stata confermata: la PCR
non rileva SARS-CoV-2, ma sequenze
geniche endogene

Le sequenze genetiche utilizzate nelle PCR per rilevare la sospetta SARS-CoV-2 e per
diagnosticare casi di malattia e morte attribuiti al Covid-19 sono presenti in dozzine di
sequenze del genoma umano stesso e in quelle di un centinaio di microbi. E questo
include gli iniziatori o primer, i frammenti più estesi presi a caso dal loro presunto
"genoma" e persino i cosiddetti "geni bersaglio" presumibilmente specifici per il
"nuovo coronavirus". Il test è inutile e tutti i risultati "positivi" ottenuti fino ad ora
devono essere scientificamente invalidati e comunicati agli interessati; e se sono
deceduti, ai loro parenti. Stephen Bustin, uno dei massimi esperti mondiali di PCR,
afferma infatti che in determinate condizioni chiunque può risultare positivo!
Ti abbiamo avvisato da marzo: non puoi eseguire test specifici per un virus senza conoscere i
componenti del virus che stai cercando di rilevare. E i componenti non possono essere
conosciuti senza aver precedentemente isolato / purificato quel virus. Da allora continuiamo
ad accumulare, prova che nessuno ha isolato SARS-CoV-2 e, cosa più importante, che non
potrà mai essere isolato per i motivi che abbiamo spiegato il mese scorso (leggi il report
"Puoi provare che esistono virus patogeni?" Sul nostro sito web -www.dsalud.com-). E nel

presente rapporto offriremo nuovi dati che dimostrano che RT-PCR non rileva il cosiddetto
SARS-CoV-2 come è noto, ma frammenti di RNA umano e quelli di numerosi microbi.
Abbiamo già spiegato i numerosi problemi che pone la RT-PCR, riconosciuti da
organizzazioni o governi come l'OMS o il CDC e da prestigiosi esperti internazionali come il
Dr. Stephen Bustinche considera nonsense sia l'arbitrarietà di stabilire criteri per i risultati
sia la scelta del numero di cicli perché portare a risultati positivi per chiunque. In questo
report aggiungeremo i risultati di una particolare ricerca che abbiamo fatto dai dati pubblicati
sulla presunta SARS-CoV-2 e sui protocolli approvati dall'OMS per l'uso della RT-PCR
nonché i dati corrispondenti al resto dei "coronavirus umani". E le conclusioni sono
estremamente serie: nessuno dei sette "coronavirus umani" è stato effettivamente isolato e
tutte le sequenze dei primer delle PCR così come quelle di un gran numero di frammenti dei
loro presunti genomi si trovano in diverse aree di il genoma umano e nei genomi di batteri e
archei, come questi: Shwanella marina JCM,
Spiegheremo passo dopo passo la ricerca che ci ha portato a una conclusione così insolita.
SONO STATI ISOLATI CORONAVIRUS UMANI?
Durante la prima metà di aprile, quando la prima ricerca che abbiamo condotto ha indicato
che SARS-CoV-2 non era stata isolata e poiché coloro che si affermavano di averlo fatto
facevano affidamento su "isolati" di precedenti "coronavirus umani", abbiamo iniziato a farlo
una revisione approfondita di quegli isolati dichiarati. Nello specifico, abbiamo esaminato il
presunto lavoro di isolamento dei sospetti coronavirus umani 229E (che si dice siano stati
isolati nel 1965), OC43 (nel 1967), SARS-CoV (nel 2003), NL63 (nel 2004), HKU1 (nel
2005 ) e MERSCoV (nel 2012). E questi sono stati i risultati:
Coronavirus 229E
Articolo di riferimento: Dorothy Hamre e John Proknown . Un nuovo virus isolato dal
tratto respiratorio umano . Atti della Society for Experimental Biology and Medicine, 121:
1: 190-193. 1 gennaio 1966.
Poiché gli autori fanno riferimento ad altri articoli per spiegare il metodo di isolamento - che
chiamano Complement Fixation - abbiamo consultato un articolo di riferimento per quel
metodo: quello di Janet W. Hartley et al . Saggio di fissazione del complemento e coltura
tissutale per i virus della leucemia murina PNAS, 53 (5): 931-938, maggio 1965. Questa è
una procedura già disuso che utilizza la reazione antigene-anticorpo per rilevare l'uno ol
'altro. Nel caso di cui ci occupiamo lo scopo era quello di rilevare gli antigeni del presunto
nuovo virus ma, come abbiamo già spiegato, sono necessari anticorpi specifici che non
possono essere ottenuti prima volta che viene rilevato un virus.
Coronavirus OC43
Articolo di riferimento: Paul Lee. Epidemiologia molecolare del coronavirus umano OC43 a
Hong Kong . Tesi per il Dipartimento di Microbiologia, Università di Hong Kong, agosto
2007. The HKU Scholars Hub.
Quello che era considerato RNA virale è stato estratto da colture senza alcuna prova che
l'RNA appartenga a un virus . Lo strumento utilizzato, un kit QIAamp, rimuove reagenti,
inibitori e contaminanti, ma ciò che non può fare è determinare da dove proviene l'RNA
estratto. E non ci sono controlli . Viene quindi amplificato mediante PCR e sequenziato
assumendo (!) Che si tratti di informazioni genetiche di un virus. Infine, l'autore specula su
mutazioni, ricombinazioni, genotipi, evoluzione molecolare, ceppi e altro gergo che trasmette
l'idea -non dimostrata- che si sta lavorando con un "virus".

Coronavirus SARS-CoV
Articolo di riferimento: JSM Peiris e altri . Coronavirus come possibile
causa di SARS . Lancet 361: 1319-25, aprile 2003.
Non si fa menzione della purificazione nell'articolo. Non si parla
nemmeno di filtrazione o centrifugazione. Si afferma solo che " i virus sono
stati isolati in cellule epatiche di scimmia fetale da aspirati nasofaringei e
biopsie polmonari di due pazienti ". Non ci sono controlli . L'unica
menzione è di un "effetto citopatico" attribuito a un virus e che la PCR è
stata eseguita per virus e retrovirus noti senza risultati. Infine, la RT-PCR è
stata eseguita con "iniziatori casuali" e viene rilevata una sequenza "di
origine sconosciuta" alla quale si riscontra " una debole omologia con la
famiglia delle coronaviridiae". Quindi hanno progettato i primer per
quella sequenza e durante il test di 44 campioni di pazienti con SARS solo
22 sono risultati positivi.
Coronavirus NL63
Articolo di riferimento: Lia van der Hock e altri . Identificazione di un
nuovo coronavirus umano . Nature Medicine, 10, 4 aprile 2004.
Gli autori affermano che " l'identificazione di patogeni sconosciuti utilizza
strumenti di biologia molecolare è difficile perché la sequenza target non è
nota, quindi non è possibile progettare iniziatori specifici per PCR E una
tale deduzione è corretta? Ovviamente no! Ipotesi (che si aggiunge
all'assunzione precedente che esista un virus) non tiene conto della
presenza di "particelle simili a virus", "particelle simili a retrovirus",
"retrovirus endogeni", "esosomi", lastre "extracellulari" e persino DNA
mitocondriale., ci sono una moltitudine di particelle che possiedono le
stesse caratteristiche riproduttive in grandi quantità come "virus" e quindi
può falsificare i risultatiproducendo un gran numero di copie identiche
quando tagliate dagli enzimi, come riconosciuto in un articolo sulla tecnica
VIDISCA intitolato ProSling bioinformatico avanzato delle librerie
VIDISCA per il rilevamento e la scoperta di virus. È stato pubblicato nel
volume 263 di Virus Research il 2 aprile 2019 ei suoi autori: Cormac M.
Kinsella et al. -riconoscere che " non è prevista alcuna ridondanza
nell'inserto VIDISCA dall'acido nucleico di fondo dell'ospite, tranne nel
caso di caratteristiche" simili a virus " , cioè un numero elevato di
copie come nel DNA mitocondriale".
Coronavirus HKU1
Articolo di riferimento: Patrick CY Woo e altri . Caratterizzazione e sequenza genomica
completa di un nuovo coronavirus, Coronavirus HKU1, da pazienti con polmonite . Journal
of Virology, 79, 2, gennaio 2005.

L'articolo, incredibilmente, inizia con queste parole: " Nonostante le ricerche approfondite su
pazienti con infezioni del tratto respiratorio, nessuna causa microbiologica è stata
identificata in una percentuale significativa di pazienti . L'RNA viene estratto da colture
non purificate". E viene utilizzata una PCR con i geni del coronavirus. Per il sequenziamento
utilizzare due database di proteine organizzati in famiglie, domini e siti funzionali -PFAM e
INterProScan- combinati con due programmi per computer che eseguono "previsioni" su
come i nucleotidi dovrebbero essere combinati. Il testo aggiunge: " Le sequenze sono state
assemblate e modificate manualmente per produrre una sequenza finale del genoma virale
".E ancora una volta non ci sono controlli .
Coronavirus MERS-CoV
Articolo di riferimento: Ali Moh Zaki e altri . Isolamento di un nuovo Coronavirus da un
uomo con polmonite in Arabia Saudita . The New England Journal of Medicine, 367:19,
novembre 2012.
Il materiale genetico viene estratto direttamente dal surnatante di coltura e dal campione
di espettorato con uno strumento chiamato High Puré Viral Nucleic Acid Kit e quindi testato
con diverse PCR per vari microrganismi noti. Non si parla di purificazione e non ci sono
controlli . In breve, ciò che era stato fatto con i primi coronavirus - e con molti altri
presunti virus - è stato quello di coltivare tessuti presumibilmente infetti - qualsiasi
"effetto citopatico" è stato attribuito solo alla presenza di un virus - e quindisi ottengono
proteine che senza alcun test vengono considerati "antigeni virali" e quando questi
"antigeni" vengono rilevati in colture si interpreta come "isolamento", oppure si
estraggono frammenti di acidi nucleici assumendo che appartengano ad un virus .

Abbiamo già spiegato nell'articolo pubblicato nel numero precedente della
rivista che secondo il Dr. Stefan Lanka il cosiddetto "effetto citopatico" è
in realtà un effetto causato dalle condizioni (avvelenamento e fame) della
cultura stessa. Ciò è riconosciuto ad esempio nell'articolo Rilascio indotto
da antibiotici di piccole vescicole extracellulari (esosomi) con DNA
associato alla superficie pubblicato il 15 agosto 2017 sul sito di Nature e
firmato da Andrea Németh e altri
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5557920/pdf/41598_201
7_Article_8392.pdf
Spiega che alcune sostanze, come gli antibiotici, aggiunte a esperimenti in
vitro possono stressare le colture cellulari in modo da generare nuove
sequenze che non erano state rilevate in precedenza. Questo era già stato
notato nientemeno che dalla dott.ssa Barbara McClintock nel 1983
durante la sua conferenza per il premio Nobel
In sostanza, NESSUNO DEI SETTE SUPPOSTI CORONAVIRUS UMANO È
STATO DAVVERO ISOLATO . L'unica cosa che è stata diversa tra loro sono le procedure
e le tecniche di laboratorio che stanno diventando progressivamente più sofisticate che, in
questo caso, hanno implicato non una precisione maggiore ma una maggiore capacità di
inganno e autoinganno che è culminata nella virtuale virtuale della SARS-CoV-2.
E l'ovvia conseguenza della mancanza di prova del suo isolamento è che tali "coronavirus"
non possono essere ritenuti responsabili di alcuna malattia . Inoltre, tutti i test - di

qualsiasi natura - i componenti di questi "virus" (acidi nucleici o proteine) sono
completamente squalificati come "test di infezione" e ancor più come "diagnosi" di malattie.

ALTRE RICHIESTE NON RISPOSTE
Nel numero precedente abbiamo già raccolto le risposte fornite dagli autori
di diversi articoli che presumibilmente descrivono l'isolamento di SARSCoV-2 in cui si riconosce non aver "purificato" il che significa
implicitamente riconosciuto che il virus non era isolato. E ora
aggiungeremo un'altra prova: le risposte date da diverse autorità - politiche
e sanitarie - di vari paesi sulla purificazione e l'isolamento della SARS-CoV2.
James McCumiskey -autore del libro The Latest Conspiracy: The
Biomedical Paradigm - ci dice che il National Virus Reference Laboratory
of Ireland ha richiesto informazioni in merito all'Università di Dublino e
quest'ultimo ha risposto che " non ha record che potrebbero fornire
una risposta a la loro richiesta ". Il direttore dei servizi legali del
laboratorio ha insistito sulla sua richiesta all'università e l'università ha
risposto come segue: " La posizione dell'università è che il materiale del
dibattito accademico non può essere soggetto al Freedom of Information
Act ". Risulta dalla richiesta dell'NVR che non hanno coltivato SARSCoV-2 o purificato. Riconoscono solo di aver " rilevato SARS-CoV-2
RNA in campioni diagnostici "
Il 22 giugno un gruppo di esperti ha inviato una consultazione in termini
simili al primo ministro britannico Boris Johnson . La lettera era firmata
dal dott. Kevin Corbett, Piers Corbyn - professore all'Imperial College
di Londra -, l'ingegnere e ricercatore indipendente - che a quel tempo
intervistammo sulla rivista - David Crowe, il dott.Andrew Kaufman ,
il professore di biologia di Edimburgo Roger Watson e il biologo e
chimico David Rasnick - e fino ad oggi non hanno ancora ricevuto
risposta!
Un'altra richiesta simile in questo caso al Consiglio nazionale delle ricerche del Canada - ha
ricevuto la seguente risposta: " Non siamo stati in grado di effettuare una ricerca completa
dei record dell'NRC, quindi ci dispiace informarti che non sono stati identificati record che
rispondono alla tua richiesta. "Aggiungeremo che due giornalisti hanno inviato richieste
simili - ai sensi del Freedom of Information Act - a varie istituzioni in Canada, Nuova
Zelanda, Australia, Germania, Regno Unito e Stati Uniti e dal 5 settembre, dodici istituzioni
hanno risposto, indicando tutte la stessa cosa: che non hanno traccia di lavori che descrivono
l'isolamento del virus che dovrebbe causare Covid-19 .I dettagli e le risposte possono essere
visti su
https://www.fluoridefreepeel.ca/uk-dept-of-health-and-social-care-has-no-record-ofcovid-19virus-isolation/

ALLA RICERCA DELL'ORIGINE DEL FALSO GENOMA
La domanda che ci siamo posti allora è stata: se le sequenze che sono state
non appartengono - come annunciati - a nuovi virus, da dove vengono? E

per provare a rispondere a questa domanda abbiamo deciso di effettuare
una ricerca con un programma informatico chiamato
Basic Local Alignment Search Tool (BLAST) , uno strumento di ricerca
dell'allineamento di sequenze che ci permette di leggere una data sequenza
con tutte le sequenze memorizzate negli Istituti Nazionali of Health of the
United States (è pubblico e può essere consultato su
https://blast.ncbi.nlm.nih.gov/Blast.cgi . Spieghiamo passo dopo passo
cosa abbiamo fatto affinché i nostri lettori possano ripetere la ricerca stessi
e controllare i risultati.
Spieghiamo passo dopo passo cosa abbiamo fatto affinché i nostri lettori
possano ripetere la ricerca stessi e controllare i risultati.
Per prima cosa abbiamo raccolto tutti gli iniziatori delle PCR descritte nei
protocolli ospitati sul sito web dell'OMS all'epoca che erano questi:


Protocollo China CDC: utilizza i geni ORF1ab e N come target.



Protocollo dell'Istituto Pasteur (Francia): utilizza due frammenti del
RdRP (che dovrebbe essere specifico per SARS.CoV-2).



Protocollo CDC degli Stati Uniti: utilizza tre frammenti del gene N.



Protocollo dell'Istituto Nazionale delle Malattie Infettive del Giappone:
è l'unico che ha come bersaglio il gene S insieme ad altri geni
presumibilmente condivisi con altri coronavirus.



Protocollo Charite (Germania): utilizza i geni E, N e RdRP. - Protocollo
dell'Università di Hong Kong: utilizza ORF1b-nsp14 e il gene N.



Protocollo del National Institute of Health Thailand: utilizza il gene N.

Abbiamo quindi introdotto la sequenza dei primer - quella indica l'inizio
della sequenza da rilevare (in avanti) e quella che indica la finale (inversa)
– nel BLAST in modo che possa ricercarli in due database: a raccolta dei genomi microbici e
quella corrispondente al genoma umano.

LE SEQUENZE DEL COSIDDETTO SARS-COV-2 SI TROVANO
SIA NEGLI UMANI CHE IN NUMEROSI MICROBI!
Vediamo nel dettaglio la procedura prendendo come esempio gli iniziatori
del protocollo francese. Una volta sul sito web BLAST , abbiamo scelto
Microbes per cercare nel database del genoma microbico e siamo passati
alla pagina successiva. Quindi è apparso un modulo in cui abbiamo inserito
la sequenza dell'iniziatore in avanti del protocollo francese - cioè
ATGAGCTTAGTCCTGTG -, abbiamo selezionato le sequenze molto
simili e premuto il tasto BLAST . Pochi secondi dopo sono comparsi i
risultati - abbiamo fatto uno screenshot ( immagine 1 ) - e ci sono state
mostrate 100 sequenze di microbi- in particolare batteri e archeobatteri

- con una coincidenza tra il 77% e il 100% con una percentuale di identità
del 100%.
Siamo quindi tornati alla home page e la seconda volta che abbiamo scelto
Human per la ricerca nel genoma umano, abbiamo ripetuto la stessa
operazione e dopo pochi secondi è apparso il risultato che abbiamo
catturato nuovo (immagine 2). E si scopre che la sequenza inserita coincide
con 74 sequenze del genoma umano , con una coincidenza compresa
tra il 66% e il 100% e una percentuale di identità del 100%.
E questo indica che la sequenza di quel primer PCR iniziale che
dovrebbe essere specifico per SARS-CoV-2 corrisponde in realtà
a 74 frammenti del genoma umano e anche a cento frammenti
microbici !
Abbiamo quindi deciso di ripetere l'operazione ma con il primer finale o
inverso - che è CTCCCTTTGTGTGTGT - ei risultati sono stati simili.
Trattandosi di sequenze molto brevi -una ventina di lettere genetiche o
nucleotidi- abbiamo deciso di riprovare ma con la sequenza target definita
da questi due primer, ovvero la sequenza del presunto genoma SARS-CoV2 che si trova
tra il primer iniziale e il primer finale . Ovviamente, per questo c'era
bisogno della sequenza che è dichiarata essere il "genoma SARS-CoV-2" e
sebbene migliaia di laboratori affermino di averlo isolato e sequenziato una falsa affermazione come abbiamo spiegato in precedenti rapportiabbiamo deciso di farlo vai al sito web
https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2?%20report=genban
k&to=29903
del Centro nazionale per l'informazione sulle biotecnologie : Una volta lì,
abbiamo localizzato la "sequenza target", un frammento di 108 nucleotidi
localizzato tra le posizioni 12.690 e 12.797 del "genoma", che è questo:
ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACA
CAAACTGCTTGCACTGAT
GACAATGCGTTAGCTTACAACAACAAAGGGAG .
Con questo abbiamo ripetuto i passaggi precedentemente definiti i risultati
sono stati ancora una volta sorprendenti poiché sono apparse nuovamente
un centinaio di sequenze microbiche con una percentuale di
corrispondenza del 100% e quattro sequenze del genoma umano
con una percentuale di identità compresa tra 83% e 95 % . Le
corrispondenze sono state quindi inferiori ma l'importante è che
continuiamo a trovare frammenti della presunta "sequenza
bersaglio" di SARS-CoV-2 sia nei microbi che nel nostro stesso
genoma .

Con questo abbiamo ripetuto i passaggi precedentemente definiti i risultati
sono stati ancora una volta sorprendenti poiché sono apparse nuovamente
un centinaio di sequenze microbiche con una percentuale di
corrispondenza del 100% e quattro sequenze del genoma umano
con una percentuale di identità compresa tra 83% e 95 % . Le
corrispondenze sono state quindi inferiori ma l'importante è che
continuiamo a trovare frammenti della presunta "sequenza
bersaglio" di SARS-CoV-2 sia nei microbi che nel nostro stesso
genoma .
Veramente stupito ABBIAMO Fatto un Ulteriore passo e testati con il gene
considerato un quel tempo Venuto il Più SPECIFICO di SARS-CoV-2, il
gene E che dovrebbe Generare le proteine dell'involucro e si TROVA Tra le
POSIZIONI 26.245 e 26,472:
ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTT
AATAGCGTACTTCTCTTGCTTTCGTGGTATTCTTGCTAGTTACACT
AGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTGTTAACG
TGAGTCTTGTAAAACCTTTACGTTTACTCGTGTTAAAATCTGAAT
TCTTCTAGAGTTCG ATTCTGGTCTAA .
Abbiamo ripetuto con esso i passaggi già e il risultato è stato ancora più
sorprendente perché nonostante la sua lunghezza sono apparse altre
cento sequenze microbiche con una percentuale di identità del
100% e 10 sequenze del genoma umano con una percentuale di
identità compresa tra l '80 % e il 100%. E risultati simili sono
stati ottenuti con un frammento scelto un caso e con il gene N
che si dice corrisponda alle proteine del nucleocapside SARSCoV-2 .
Alla fine abbiamo deciso di testare con il gene S che si dice generi le
proteine "spike" strutturali che sono fondamentali per l'ingresso nella
cellula e che successivamente è stato considerato il gene SARSCoV-2 più
specifico. Poiché si tratta di un gene la cui sequenza è molto più lunga 3821 nucleotidi tra le posizioni 21,563 e 25,384 - abbiamo testato con due
frammenti scelti a caso all'interno di quel gene e il primo TTGGCAAAATTCAAGACTCACTTTC - ha prodotto un altro centinaio
di sequenze di microbi e 93 sequenze del genoma umano e il secondo CTTGCTGCTACTAAATGCAGAGTGT - un centinaio di sequenze
microbiche e 90 del genoma umano.
Alla fine abbiamo deciso di testare con gli iniziatori del Japan Protocol,
l'unico che include sequenze target del gene S e, il lettore ha già intuito, i
risultati sono stati ancora una volta simili: un centinaio di sequenze di microbi e

93 sequenze di genoma umano con una percentuale di identità compresa tra il 94,12% e
il 100% !

CONCLUSIONI
La conseguenza di tutto ciò che abbiamo appena spiegato è chiara e
immediata:
NON ESISTE TEST VALIDO PER RILEVARE SARS-COV-2 , né test
anticorpali o antigene né RT-PCR. E abbiamo incluso quelli sul presunto
gene che codifica per la proteina S1 o spike. E questo significa che TUTTI I
NUMERI DI "CASI", "INFETTI", "MALATI", "Asintomatici" O
"MORTI A CAUSA DI COVID-19" MANCANO DI UNA BASE
SCIENTIFICA E TUTTI I "POSITIVI" SONO FALSI POSITIVI ,
qualcosa che essere comunicato immediatamente alle persone colpite ei
responsabili dovrebbero essere ritenuti responsabili.
Concludiamo aggiungendo che anche la stessa OMS non crede veramente a
questi test. Basta leggere il documento pubblicato lo scorso 11 settembre
come guida di laboratorio per SARS-CoV-2 intitolato Test diagnostici per
SARS-CoV-2 - è disponibile su
https://apps.who.int/iris/rest/bitstreams/1302661/retrieve - e si legge
letteralmente a pagina 5: "Quando possibile, la sospetta infezione attiva
dovrebbe essere testata con un test di amplificazione degli acidi nucleici
(NAAT) come RT-PCR. I test NAAT dovrebbero mirare al genoma di
SARS-CoV-2 ma poiché c'è nessuna circolazione globale nota di SARSCoV-1 una sequenza di Sarbecovirus (che si presume includa almeno
cinque coronavirus umani e animali tra cui SARS-CoV-1 e SARS-Cov-2) è
anche un obiettivo ragionevole ". L'OMS accetta di utilizzare
sequenze non specifiche per rilevare SARS-CoV-2 .
Il manuale afferma:Una diagnosi ottimale consiste in un test NAAT con
almeno due bersagli indipendenti dal genoma del SARS-CoV-2; tuttavia,
nelle aree in cui la trasmissione è diffusa, un semplice algoritmo a
bersaglio singolo può essere utilizzato . "
Uno o più risultati negativi non escludono necessariamente
l'infezione da SARSCoV-2 . Ci sono una serie di fattori che possono
produrre un risultato negativo in un individuo infetto, inclusa la scarsa
qualità del campione, la raccolta tardiva del campione, trattamento
inadeguato, o ragioni tecniche inerenti al test, come la mutazione del virus
o l'inibizione della PCR. ”Cosa aspettano i giudici per agire di propria
iniziativa?
Cosa aspettano i giudici per agire di propria iniziativa?

Commenti miei
Non hanno "isolato" proprio nulla.
Nessun ISOLATO PURIFICATO di virioni integri attivi, naturali, non
sintetici.
Solita bufala, e tutti gli isolamenti globali annunciati dopo Wuhan sono
identici.
E' solo la solita RT-qPCR, qui fatta su 4 campioni di presunti virioni di
CoV2 presi da BALF/SWAB di presunti malati, NON PURIFICATI, lisati in
RNA e poi mandati al sequenziamento NGS.
Ossia ad una Ricostruzione Bioinformatica di sequenza, rimontando
milioni di 'contig' (bit di sequenze) ricavati dall'RNA lisato dal campione
(trasformato in cDNA e amplificato dalle RT-qPCR) e caricati in un PC per
rimapparli alla meglio e cercare il miglior 'consenso' possibile sulla solita
sequenza madre di riferimento, ossia la prima pubblicata, la Wuhan-HU01.
Come tutti gli altri "isolamenti" annunciati al mondo dopo Wuhan si tratta
solo di Sequenziamenti bioinformatici su tutto l'RNA presente nel
campione/surnatante, il che la dice lunga sulla quantità di materiale
genetico anche endogeno umano che possa essere presente oltre ai presunti
patogeni.
E dopo una coltura cellulare è anche peggio visto che si hanno passaggi
multipli aggiuntivi in colture cellulari animali immortalate trasfettate
chimicamente e coperte di antibiotici.
Di fatto sono solo RT-qPCR da campioni o surnatanti NON PURIFICATI.
Gli unici isolamenti ESCLUSI (teoricamente) da questa modalità sono
SOLO un PAIO, ossia i primi 2 "ISOLAMENTI" fatti a WHUAN, che pare
abbiano eseguito molti dei passaggi necessari per un presunto NUOVO
patogeno, purtroppo anche in quel caso (ci sono gli studi peer reviewed)
SENZA PURIFICARE I VIRIONI quindi è un tutto un assoluto fake fin
dall'inizio.
Le prime sequenze inviate da Whuan in GISAID sono probabilmente la
radice della truffa, di quelle sequenze non si sa nulla sulla vera procedura
completa e particolareggiata e sui metodi dettagliati, solo 2 studi, i più noti,
ne parlano in modo limitato e generico, ricordo che stiamo parlando di un
presunto NUOVO patogeno PANDEMICO globale.

Come se non bastasse, già da gennaio NON ESISTONO PIU' I CAMPIONI
UMANI ORIGINALI di Wuhan, la Cina NON li ha mai forniti, i CAMPIONI
ORIGINALI SONO SPARITI da prima dell'11 gennaio 2020 ossia prima
della data in cui Wuhan ha inviato le prime due sequenze in GISAID e in
GenBank.



Parole chiave correlate