File PDF .it

Condividi facilmente i tuoi documenti PDF con i tuoi contatti, il Web e i Social network.

Inviare un file File manager Cassetta degli attrezzi Ricerca PDF Assistenza Contattaci



postdeipost .pdf



Nome del file originale: postdeipost.pdf
Autore: Utente Windows

Questo documento in formato PDF 1.6 è stato generato da Acrobat PDFMaker 19 per Word / Adobe PDF Library 19.12.66, ed è stato inviato su file-pdf.it il 18/02/2021 alle 02:41, dall'indirizzo IP 79.26.x.x. La pagina di download del file è stata vista 87 volte.
Dimensione del file: 222 KB (8 pagine).
Privacy: file pubblico




Scarica il file PDF









Anteprima del documento


Molto probabilmente questo post verrà eliminato...quindi salvate..
Si parla dello strumento di paragone tra sequenze geniche definito BLAST (Basic Local Alignment Search
Tool) ben utilizzato da parte degli "addetti" ai lavori chiamamoli cosi, per andare a scegliere quegli iniziatori
(primers) della reazione a catena della polimerase (PCR) non sufficientemente specifici del vairus mai isolato
che ha distrutto la nostra società. Fortunatamente questo strumento è ancora disponibile a tutti e, grazie ad
alcuni scienziati volonterosi e coscienziosi, si è potuti risalire agli innumerevoli virus e batteri che il test,
strutturato come da protocolli indicati da OMS, potrebbe rilevare, ponendoci di fronte al dubbio, o alla
certezza, della pandemia pilotata tramite numero di contagi volutamente gonfiato a suon di falsi positivi.
La truffa è stata confermata: la PCR non rileva S-CoV-2, ma sequenze geniche endogene
Le sequenze genetiche utilizzate nelle PCR per rilevare il sospetto S-CoV-2 e per diagnosticare casi di
malattia e morte attribuiti al C-19 sono presenti in dozzine di sequenze del genoma umano stesso e in quelle
di un centinaio di microbi. E questo include gli iniziatori o primer, i frammenti più estesi presi a caso dal loro
presunto "genoma" e persino i cosiddetti "geni bersaglio" presumibilmente specifici per il "nuovo
coronavirus". Il test è inutile e tutti i risultati "positivi" ottenuti fino ad ora devono essere scientificamente
invalidati e comunicati agli interessati; e se sono deceduti, ai loro parenti. Stephen Bustin, uno dei massimi
esperti mondiali di PCR, afferma infatti che in determinate condizioni chiunque può risultare positivo!
E' da marzo che si sa: non puoi eseguire test specifici per un virus senza conoscere i componenti del virus
che stai cercando di rilevare. E i componenti non possono essere conosciuti senza aver precedentemente
isolato / purificato quel virus. Da allora continuiamo ad accumulare, prove che nessuno ha isolato S-CoV-2
e, cosa più importante, che non potrà mai essere isolato... E nel presente rapporto nuovi dati che dimostrano
che RT-PCR non rileva il cosiddetto S-CoV-2 come è noto, ma frammenti di RNA umano e quelli di numerosi
microbi.

Abbiamo già spiegato i numerosi problemi che pone la RT-PCR, riconosciuti da organizzazioni o governi
come l'OMS o il CDC e da prestigiosi esperti internazionali come il Dr. Stephen Bustinche considera
nonsense sia l'arbitrarietà di stabilire criteri per i risultati sia la scelta del numero di cicli perché portare a
risultati positivi per chiunque. In questo report aggiungeremo i risultati di una particolare ricerca che abbiamo
fatto dai dati pubblicati sulla presunta SARS-CoV-2 e sui protocolli approvati dall'OMS per l'uso della RTPCR nonché i dati corrispondenti al resto dei "coronavirus umani". E le conclusioni sono estremamente
serie: nessuno dei sette "coronavirus umani" è stato effettivamente isolato e tutte le sequenze dei primer
delle PCR così come quelle di un gran numero di frammenti dei loro presunti genomi si trovano in diverse
aree di il genoma umano e nei genomi di batteri e archei, come questi: Shwanella marina JCM,
Spiegheremo passo dopo passo la ricerca che ci ha portato a una conclusione così insolita.
SONO STATI ISOLATI CORONAVIRUS UMANI?
Durante la prima metà di aprile, quando la prima ricerca che abbiamo condotto ha indicato che SARS-CoV-2
non era stata isolata e poiché coloro che si affermavano di averlo fatto facevano affidamento su "isolati" di
precedenti "coronavirus umani", abbiamo iniziato a farlo una revisione approfondita di quegli isolati dichiarati.
Nello specifico, abbiamo esaminato il presunto lavoro di isolamento dei sospetti coronavirus umani 229E
(che si dice siano stati isolati nel 1965), OC43 (nel 1967), SARS-CoV (nel 2003), NL63 (nel 2004), HKU1
(nel 2005 ) e MERSCoV (nel 2012). E questi sono stati i risultati:
Coronavirus 229E
Articolo di riferimento: Dorothy Hamre e John Proknown . Un nuovo virus isolato dal tratto respiratorio umano
. Atti della Society for Experimental Biology and Medicine, 121: 1: 190-193. 1 gennaio 1966.
Poiché gli autori fanno riferimento ad altri articoli per spiegare il metodo di isolamento - che chiamano
Complement Fixation - abbiamo consultato un articolo di riferimento per quel metodo: quello di Janet W.
Hartley et al . Saggio di fissazione del complemento e coltura tissutale per i virus della leucemia murina
PNAS, 53 (5): 931-938, maggio 1965. Questa è una procedura già disuso che utilizza la reazione antigeneanticorpo per rilevare l'uno ol 'altro. Nel caso di cui ci occupiamo lo scopo era quello di rilevare gli antigeni
del presunto nuovo virus ma, come abbiamo già spiegato, sono necessari anticorpi specifici che non
possono essere ottenuti prima volta che viene rilevato un virus.
Coronavirus OC43
Articolo di riferimento: Paul Lee. Epidemiologia molecolare del coronavirus umano OC43 a Hong Kong . Tesi
per il Dipartimento di Microbiologia, Università di Hong Kong, agosto 2007. The HKU Scholars Hub.
Quello che era considerato RNA virale è stato estratto da colture senza alcuna prova che l'RNA appartenga
a un virus . Lo strumento utilizzato, un kit QIAamp, rimuove reagenti, inibitori e contaminanti, ma ciò che non
può fare è determinare da dove proviene l'RNA estratto. E non ci sono controlli . Viene quindi amplificato
mediante PCR e sequenziato assumendo (!) Che si tratti di informazioni genetiche di un virus. Infine, l'autore
specula su mutazioni, ricombinazioni, genotipi, evoluzione molecolare, ceppi e altro gergo che trasmette
l'idea -non dimostrata- che si sta lavorando con un "virus".
Coronavirus SARS-CoV
Articolo di riferimento: JSM Peiris e altri . Coronavirus come possibile causa di SARS . Lancet 361: 1319-25,
aprile 2003.
Non si fa menzione della purificazione nell'articolo. Non si parla nemmeno di filtrazione o centrifugazione. Si
afferma solo che " i virus sono stati isolati in cellule epatiche di scimmia fetale da aspirati nasofaringei e
biopsie polmonari di due pazienti ". Non ci sono controlli . L'unica menzione è di un "effetto citopatico"
attribuito a un virus e che la PCR è stata eseguita per virus e retrovirus noti senza risultati. Infine, la RT-PCR
è stata eseguita con "iniziatori casuali" e viene rilevata una sequenza "di origine sconosciuta" alla quale si

riscontra " una debole omologia con la famiglia delle coronaviridiae". Quindi hanno progettato i primer per
quella sequenza e durante il test di 44 campioni di pazienti con SARS solo 22 sono risultati positivi.
Coronavirus NL63
Articolo di riferimento: Lia van der Hock e altri . Identificazione di un nuovo coronavirus umano . Nature
Medicine, 10, 4 aprile 2004.
Gli autori affermano che " l'identificazione di patogeni sconosciuti utilizza strumenti di biologia molecolare è
difficile perché la sequenza target non è nota, quindi non è possibile progettare iniziatori specifici per PCR E
una tale deduzione è corretta? Ovviamente no! Ipotesi (che si aggiunge all'assunzione precedente che
esista un virus) non tiene conto della presenza di "particelle simili a virus", "particelle simili a retrovirus",
"retrovirus endogeni", "esosomi", lastre "extracellulari" e persino DNA mitocondriale., ci sono una moltitudine
di particelle che possiedono le stesse caratteristiche riproduttive in grandi quantità come "virus" e quindi può
falsificare i risultatiproducendo un gran numero di copie identiche quando tagliate dagli enzimi, come
riconosciuto in un articolo sulla tecnica VIDISCA intitolato ProSling bioinformatico avanzato delle librerie
VIDISCA per il rilevamento e la scoperta di virus. È stato pubblicato nel volume 263 di Virus Research il 2
aprile 2019 ei suoi autori: Cormac M. Kinsella et al. -riconoscere che " non è prevista alcuna ridondanza
nell'inserto VIDISCA dall'acido nucleico di fondo dell'ospite, tranne nel caso di caratteristiche" simili a virus " ,
cioè un numero elevato di copie come nel DNA mitocondriale".
Coronavirus HKU1
Articolo di riferimento: Patrick CY Woo e altri . Caratterizzazione e sequenza genomica completa di un nuovo
coronavirus, Coronavirus HKU1, da pazienti con polmonite . Journal of Virology, 79, 2, gennaio 2005.
L'articolo, incredibilmente, inizia con queste parole: " Nonostante le ricerche approfondite su pazienti con
infezioni del tratto respiratorio, nessuna causa microbiologica è stata identificata in una percentuale
significativa di pazienti . L'RNA viene estratto da colture non purificate". E viene utilizzata una PCR con i geni
del coronavirus. Per il sequenziamento utilizzare due database di proteine organizzati in famiglie, domini e
siti funzionali -PFAM e INterProScan- combinati con due programmi per computer che eseguono "previsioni"
su come i nucleotidi dovrebbero essere combinati. Il testo aggiunge: " Le sequenze sono state assemblate e
modificate manualmente per produrre una sequenza finale del genoma virale ".E ancora una volta non ci
sono controlli .
Coronavirus MERS-CoV
Articolo di riferimento: Ali Moh Zaki e altri . Isolamento di un nuovo Coronavirus da un uomo con polmonite in
Arabia Saudita . The New England Journal of Medicine, 367:19, novembre 2012.
Il materiale genetico viene estratto direttamente dal surnatante di coltura e dal campione di espettorato con
uno strumento chiamato High Puré Viral Nucleic Acid Kit e quindi testato con diverse PCR per vari
microrganismi noti. Non si parla di purificazione e non ci sono controlli . In breve, ciò che era stato fatto con i
primi coronavirus - e con molti altri presunti virus - è stato quello di coltivare tessuti presumibilmente infetti qualsiasi "effetto citopatico" è stato attribuito solo alla presenza di un virus - e quindisi ottengono proteine
che senza alcun test vengono considerati "antigeni virali" e quando questi "antigeni" vengono rilevati in
colture si interpreta come "isolamento", oppure si estraggono frammenti di acidi nucleici assumendo che
appartengano ad un virus .
Abbiamo già spiegato nell'articolo pubblicato nel numero precedente della rivista che secondo il Dr. Stefan
Lanka il cosiddetto "effetto citopatico" è in realtà un effetto causato dalle condizioni (avvelenamento e fame)
della cultura stessa. Ciò è riconosciuto ad esempio nell'articolo Rilascio indotto da antibiotici di piccole
vescicole extracellulari (esosomi) con DNA associato alla superficie pubblicato il 15 agosto 2017 sul sito di
Nature e firmato da Andrea Németh e altri
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5557920/pdf/41598_2017_Article_8392.pdf
Spiega che alcune sostanze, come gli antibiotici, aggiunte a esperimenti in vitro possono stressare le colture
cellulari in modo da generare nuove sequenze che non erano state rilevate in precedenza. Questo era già

stato notato nientemeno che dalla dott.ssa Barbara McClintock nel 1983 durante la sua conferenza per il
premio Nobel
In sostanza, NESSUNO DEI SETTE SUPPOSTI CORONAVIRUS UMANO È STATO DAVVERO ISOLATO .
L'unica cosa che è stata diversa tra loro sono le procedure e le tecniche di laboratorio che stanno diventando
progressivamente più sofisticate che, in questo caso, hanno implicato non una precisione maggiore ma una
maggiore della SARS-CoV-2.
E l'ovvia conseguenza della mancanza di prova del suo isolamento è che tali "coronavirus" non possono
essere ritenuti responsabili di alcuna malattia . Inoltre, tutti i test - di qualsiasi natura - i componenti di questi
"virus" (acidi nucleici o proteine) sono completamente squalificati come "test di infezione" e ancor più come
"diagnosi" di malattie.
ALTRE RICHIESTE NON RISPOSTE
Nel numero precedente abbiamo già raccolto le risposte fornite dagli autori di diversi articoli che
presumibilmente descrivono l'isolamento di SARS-CoV-2 in cui si riconosce non aver "purificato" il che
significa implicitamente riconosciuto che il virus non era isolato. E ora aggiungeremo un'altra prova: le
risposte date da diverse autorità - politiche e sanitarie - di vari paesi sulla purificazione e l'isolamento della
SARS-CoV-2.
James McCumiskey -autore del libro The Latest Conspiracy: The Biomedical Paradigm - ci dice che il
National Virus Reference Laboratory of Ireland ha richiesto informazioni in merito all'Università di Dublino e
quest'ultimo ha risposto che " non ha record che potrebbero fornire una risposta a la loro richiesta ". Il
direttore dei servizi legali del laboratorio ha insistito sulla sua richiesta all'università e l'università ha risposto
come segue: " La posizione dell'università è che il materiale del dibattito accademico non può essere
soggetto al Freedom of Information Act ". Risulta dalla richiesta dell'NVR che non hanno coltivato SARSCoV-2 o purificato. Riconoscono solo di aver " rilevato SARS-CoV-2 RNA in campioni diagnostici " .
Il 22 giugno un gruppo di esperti ha inviato una consultazione in termini simili al primo ministro britannico
Boris Johnson . La lettera era firmata dal dott. Kevin Corbett, Piers Corbyn - professore all'Imperial College
di Londra -, l'ingegnere e ricercatore indipendente - che a quel tempo intervistammo sulla rivista - David
Crowe, il dott.Andrew Kaufman , il professore di biologia di Edimburgo Roger Watson e il biologo e chimico
David Rasnick - e fino ad oggi non hanno ancora ricevuto risposta!
Un'altra richiesta simile - in questo caso al Consiglio nazionale delle ricerche del Canada - ha ricevuto la
seguente risposta: " Non siamo stati in grado di effettuare una ricerca completa dei record dell'NRC, quindi ci
dispiace informarti che non sono stati identificati record che rispondono alla tua richiesta. "Aggiungeremo
che due giornalisti hanno inviato richieste simili - ai sensi del Freedom of Information Act - a varie istituzioni
in Canada, Nuova Zelanda, Australia, Germania, Regno Unito e Stati Uniti e dal 5 settembre, dodici
istituzioni hanno risposto, indicando tutte la stessa cosa: che non hanno traccia di lavori che descrivono
l'isolamento del virus che dovrebbe causare Covid-19 .I dettagli e le risposte possono essere visti su
https://www.fluoridefreepeel.ca/uk-dept-of-health-and-social-care-has-no-record-ofcovid-19-virus-isolation/
ALLA RICERCA DELL'ORIGINE DEL FALSO GENOMA
La domanda che ci siamo posti allora è stata: se le sequenze che sono state non appartengono - come
annunciati - a nuovi virus, da dove vengono? E per provare a rispondere a questa domanda abbiamo deciso
di effettuare una ricerca con un programma informatico chiamato Basic Local Alignment Search Tool
(BLAST) , uno strumento di ricerca dell'allineamento di sequenze che ci permette di leggere una data
sequenza con tutte le sequenze memorizzate negli Istituti Nazionali of Health of the United States (è
pubblico e può essere consultato su https://blast.ncbi.nlm.nih.gov/Blast.cgi . Spieghiamo passo dopo passo
cosa abbiamo fatto affinché i nostri lettori possano ripetere la ricerca stessi e controllare i risultati.
Per prima cosa abbiamo raccolto tutti gli iniziatori delle PCR descritte nei protocolli ospitati sul sito web
dell'OMS all'epoca che erano questi:

Protocollo China CDC: utilizza i geni ORF1ab e N come target.
Protocollo dell'Istituto Pasteur (Francia): utilizza due frammenti del RdRP (che dovrebbe essere specifico per
SARS.CoV-2).
Protocollo CDC degli Stati Uniti: utilizza tre frammenti del gene N.
Protocollo dell'Istituto Nazionale delle Malattie Infettive del Giappone: è l'unico che ha come bersaglio il gene
S insieme ad altri geni presumibilmente condivisi con altri coronavirus.
Protocollo Charite (Germania): utilizza i geni E, N e RdRP. - Protocollo dell'Università di Hong Kong: utilizza
ORF1b-nsp14 e il gene N.
Protocollo del National Institute of Health Thailand: utilizza il gene N.
Abbiamo quindi introdotto la sequenza dei primer - quella indica l'inizio della sequenza da rilevare (in avanti)
e quella che indica la finale (inversa) - nel BLAST in modo che possa ricercarli in due database: a raccolta
dei genomi microbici e quella corrispondente al genoma umano.
LE SEQUENZE DEL COSIDDETTO SARS-COV-2 SI TROVANO SIA NEGLI UMANI CHE IN NUMEROSI
MICROBI!
Vediamo nel dettaglio la procedura prendendo come esempio gli iniziatori del protocollo francese. Una volta
sul sito web BLAST , abbiamo scelto Microbes per cercare nel database del genoma microbico e siamo
passati alla pagina successiva. Quindi è apparso un modulo in cui abbiamo inserito la sequenza
dell'iniziatore in avanti del protocollo francese -che è ATGAGCTTAGTCCTGTG -, abbiamo selezionato le
sequenze molto simili e abbiamo premuto il tasto BLAST . Pochi secondi dopo sono comparsi i risultati abbiamo fatto uno screenshot ( immagine 1 ) - e ci sono state mostrate 100 sequenze di microbi- in
particolare batteri e archeobatteri - con una coincidenza tra il 77% e il 100% con una percentuale di identità
del 100%.
Siamo quindi tornati alla home page e la seconda volta che abbiamo scelto Human per la ricerca nel
genoma umano, abbiamo ripetuto la stessa operazione e dopo pochi secondi è apparso il risultato che
abbiamo catturato nuovo (immagine 2). E si scopre che la sequenza inserita coincide con 74 sequenze del
genoma umano , con una coincidenza compresa tra il 66% e il 100% e una percentuale di identità del 100%.
E questo indica che la sequenza di quel primer PCR iniziale che dovrebbe essere specifico per SARS-CoV-2
corrisponde in realtà a 74 frammenti del genoma umano e anche a cento frammenti microbici !
Abbiamo quindi deciso di ripetere l'operazione ma con il primer finale o inverso - che è
CTCCCTTTGTGTGTGT - ei risultati sono stati simili.
Trattandosi di sequenze molto brevi -una ventina di lettere genetiche o nucleotidi- abbiamo deciso di
riprovare ma con la sequenza target definita da questi due primer, ovvero la sequenza del presunto genoma
SARS-CoV-2 che si trova tra il primer iniziale e il primer finale . Ovviamente, per questo c'era bisogno della
sequenza che è dichiarata essere il "genoma SARS-CoV-2" e sebbene migliaia di laboratori affermino di
averlo isolato e sequenziato -una falsa affermazione come abbiamo spiegato in precedenti rapporti- abbiamo
deciso di farlo vai al sito web
https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2?+report=genbank&to=29903
del Centro nazionale per l'informazione sulle biotecnologie : Una volta lì, abbiamo localizzato la "sequenza
target", un frammento di 108 nucleotidi localizzato tra le posizioni 12.690 e 12.797 del "genoma", che è
questo:
ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACACAAACTGCTTGCACTGAT
GACAATGCGTTAGCTTACAACAACAAAGGGAG .
Con questo abbiamo ripetuto i passaggi precedentemente definiti i risultati sono stati ancora una volta
sorprendenti poiché sono apparse nuovamente un centinaio di sequenze microbiche con una percentuale di
corrispondenza del 100% e quattro sequenze del genoma umano con una percentuale di identità compresa
tra 83% e 95 % . Le corrispondenze sono state quindi inferiori ma l'importante è che continuiamo a trovare
frammenti della presunta "sequenza bersaglio" di SARS-CoV-2 sia nei microbi che nel nostro stesso genoma
.

Veramente stupito ABBIAMO Fatto un Ulteriore passo e testati con il gene considerato un quel tempo
Venuto il Più SPECIFICO di SARS-CoV-2, il gene E che dovrebbe Generare le proteine dell'involucro e si
TROVA Tra le POSIZIONI 26,245 e 26.472:
ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTTAATAGCGTACTTCTCTTGCTTTCGT
GGTATTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTGTTAACGTGAG
TCTTGTAAAACCTTTACGTTTACTCGTGTTAAAATCTGAATTCTTCTAGAGTTCG ATTCTGGTCTAA .
Abbiamo ripetuto con esso i passaggi già e il risultato è stato ancora più sorprendente perché nonostante la
sua lunghezza sono apparse altre cento sequenze microbiche con una percentuale di identità del 100% e 10
sequenze del genoma umano con una percentuale di identità compresa tra l '80 % e il 100%. E risultati simili
sono stati ottenuti con un frammento scelto un caso e con il gene N che si dice corrisponda alle proteine del
nucleocapside SARS-CoV-2 .
Alla fine abbiamo deciso di testare con il gene S che si dice generi le proteine "spike" strutturali che sono
fondamentali per l'ingresso nella cellula e che successivamente è stato considerato il gene SARSCoV-2 più
specifico. Poiché si tratta di un gene la cui sequenza è molto più lunga - 3821 nucleotidi tra le posizioni
21,563 e 25,384 - abbiamo testato con due frammenti scelti a caso all'interno di quel gene e il primo TTGGCAAAATTCAAGACTCACTTTC - ha prodotto un altro centinaio di sequenze di microbi e 93 sequenze
del genoma umano e il secondo - CTTGCTGCTACTAAATGCAGAGTGT - un centinaio di sequenze
microbiche e 90 del genoma umano.
Alla fine abbiamo deciso di testare con gli iniziatori del Japan Protocol, l'unico che include sequenze target
del gene S e, il lettore ha già intuito, i risultati sono stati ancora una volta simili: un centinaio di sequenze di
microbi e 93 sequenze di genoma umano con una percentuale di identità compresa tra il 94,12% e il 100% !
CONCLUSIONI
La conseguenza di tutto ciò che abbiamo appena spiegato è chiara e immediata: NON ESISTE TEST
VALIDO PER RILEVARE SARS-COV-2 , né test anticorpali o antigene né RT-PCR. E abbiamo incluso quelli
sul presunto gene che codifica per la proteina S1 o spike. E questo significa che TUTTI I NUMERI DI "CASI",
"INFETTI", "MALATI", "Asintomatici" O "MORTI A CAUSA DI COVID-19" MANCANO DI UNA BASE
SCIENTIFICA E TUTTI I "POSITIVI" SONO FALSI POSITIVI , qualcosa che essere comunicato
immediatamente alle persone colpite ei responsabili dovrebbero essere ritenuti responsabili.
Concludiamo aggiungendo che anche la stessa OMS non crede veramente a questi test. Basta leggere il
documento pubblicato lo scorso 11 settembre come guida di laboratorio per SARS-CoV-2 intitolato Test
diagnostici per SARS-CoV-2 - è disponibile su https://apps.who.int/iris/rest/bitstreams/1302661/retrieve - e si
legge letteralmente a pagina 5: "Quando possibile, la sospetta infezione attiva dovrebbe essere testata con
un test di amplificazione degli acidi nucleici (NAAT) come RT-PCR. I test NAAT dovrebbero mirare al
genoma di SARS-CoV-2 ma poiché c'è nessuna circolazione globale nota di SARS-CoV-1 una sequenza di
Sarbecovirus (che si presume includa almeno cinque coronavirus umani e animali tra cui SARS-CoV-1 e
SARS-Cov-2) è anche un obiettivo ragionevole ". Questo è, L'OMS accetta di utilizzare sequenze non
specifiche per rilevare SARS-CoV-2 .
Non è tutto perché il manuale successivamente afferma: " Una diagnosi ottimale consiste in un test NAAT
con almeno due bersagli indipendenti dal genoma del SARS-CoV-2; tuttavia, nelle aree in cui la trasmissione
è diffusa, un semplice algoritmo a bersaglio singolo può essere utilizzato . "
Il manuale dell'OMS afferma: " Uno o più risultati negativi non escludono necessariamente l'infezione da
SARSCoV-2 . Ci sono una serie di fattori che possono produrre un risultato negativo in un individuo infetto,
inclusa la scarsa qualità del campione, la raccolta tardiva del campione, trattamento inadeguato, o ragioni
tecniche inerenti al test, come la mutazione del virus o l'inibizione della PCR. ”Cosa aspettano i giudici per
agire di propria iniziativa?

Aggiungo...se non hanno isolato o meglio purificato un bel nulla..da dove prendono la presunta proteina
spike? La proteina spike codificata è un altra bufala della finta scienza... è stata in origine essenzialemente
sviluppata in cellule renali embrionali di feto abortito hek293(come ci dice tranquillamente Astrazeneca sul
bugiardino)..poi cimostrano foto di esosomi...Gli esosomi, tagliati a metà in fettine ultrasottili per la
microscopia elettronica, sono identici ai cosiddetti virus (sono anch'essi provvisti di quei chiodini che dicono
caratteristici dei coronavirus).ma agli esosomi servono per uscire dalla cellula malata non per entrarvi.... é
una "pandemia" costruita interamente su PCR/ RT-qPCR....Nessun ISOLATO PURIFICATO di virioni integri
attivi, naturali, non sintetici. Solita bufala, e tutti gli isolamenti globali annunciati dopo Wuhan sono identici. E'
solo la solita RT-qPCR, fatta su 4 campioni di presunti virioni di CoV2 presi da BALF/SWAB di presunti
malati, NON PURIFICATI, lisati in RNA e poi mandati al sequenziamento NGS. Ossia ad una Ricostruzione
Bioinformatica di sequenza, rimontando milioni di 'contig' (bit di sequenze) ricavati dall'RNA lisato dal
campione surnatante (trasformato in cDNA e amplificato dalle RT-qPCR) e caricati in un PC per rimapparli
alla meglio e cercare il miglior 'consenso' possibile sulla solita sequenza madre di riferimento, ossia la prima
pubblicata, la Wuhan-HU-01. Come tutti gli altri "isolamenti" annunciati al mondo dopo Wuhan si tratta solo
di Sequenziamenti bioinformatici su tutto l'RNA presente nel campione/surnatante, il che la dice lunga sulla
quantità di materiale genetico anche endogeno(esosomi) umano che possa essere presente oltre ai presunti
"patogeni". E dopo una coltura cellulare è anche peggio visto che si hanno passaggi multipli aggiuntivi in
colture cellulari animali immortalate trasfettate chimicamente e coperte di antibiotici. Di fatto sono solo RTqPCR da campioni o surnatanti NON PURIFICATI. Gli unici isolamenti ESCLUSI (teoricamente) da questa
modalità sono SOLO un PAIO, ossia i primi 2 "ISOLAMENTI" fatti a WHUAN, che pare abbiano eseguito
molti dei passaggi necessari per un presunto NUOVO patogeno, ma anche in quel caso (ci sono gli studi
peer reviewed) SENZA PURIFICARE I VIRIONI quindi è un tutto un assoluto fake fin dall'inizio. Le prime
sequenze inviate da Whuan in GISAID sono probabilmente la radice della truffa, di quelle sequenze non si
sa nulla sulla vera procedura completa e particolareggiata e sui metodi dettagliati, solo 2 studi, i più noti,
riportati dalla cdc, che ne parlano in modo limitato e generico, ricordo che stiamo parlando di un presunto
NUOVO patogeno "assassino" PANDEMICO globale. Come se non bastasse, già da gennaio NON
ESISTONO PIU' I CAMPIONI UMANI ORIGINALI di Wuhan, la Cina NON li ha mai forniti, i CAMPIONI
ORIGINALI SONO SPARITI da prima dell'11 gennaio 2020 ossia prima della data in cui Wuhan ha inviato le
prime due sequenze in GISAID e in GenBank. La realtà inconfutabile ad oggi, è esattamente questa: nessun
isolato purificato al mondo. Stessa cosa per lo studio Australiano che tanto piaceva alla Bolgan smentita da
Scoglio. L'isolato SARS-CoV-2 ( Betacoronavirus / Australia / SA01 / 2020 ) utilizzato in quello studio è stato
gentilmente fornito dal Peter Doherty Institute (Victoria, Australia) per conto di South Australian Health
(South Australia). Il "virus" è stato fatto passare quattro volte attraverso cellule Vero E6 (ATCC CRL-1586) in
Dulbecco's Modified Eagle Medium (DMEM) integrato con penicillina, streptomicina, Fungizone e 10% di
siero fetale di vitello e pellettato tramite ultracentrifugazione a 100.000 × g per 90 min. Il "virus" è stato
risospeso in soluzione salina tamponata con fosfato (PBS) con 1% di albumina di siero bovino (BSA) e
conservato a - 80 ° C. Lo stock di virus è stato titolato su cellule Vero E6 e il TCID 50 è stato determinato in
4,97 × 10 7 / mL con il metodo Spearman – Karber [ 12 , 13 ]. Tutto il lavoro con SARS-CoV-2 infettivo è
stato condotto nel laboratorio ad alto contenimento (livello di biosicurezza 4) presso l'Australian Center for
Disease Preparedness." Non c'è storia, la Bolgan in quel video è palesemente in confusione. Parla di NGS
ma non ha idea di cosa stia parlando; oltretutto, Sanger o Metagenomica NGS, le librerie di ampliconi sono
sempre preparate con 2 tipi di PCR (Bridge e emulsion) basate su primers e probes, templates e stampi, a
meno che non si usi lo "shotgun" metagenomico del campione totale. Il sequenziamento successivo userà le
"librerie" e/o i "contigs" di ampliconi preparati dalle PCR/ RT-qPCR, attraverso almeno 3 possibili
metodologie: Pirosequenziamento Roche-454, ILLUMINA, AB SOLiD. La metodologia dello “shotgun”
metagenomico o sequenziamento casuale probabilistico sull'intero campione totale, organico, ambientale o
misto, senza filtraggi primers, ma magari con "marker" universali di restrizione di ricerca, è utilizzato quando
non si ha idea precisa, o si ha una vaga idea, di cosa si stia cercando nel campione. Si usa la forza bruta del
calcolo e si procede per esclusione tra tutti i nucleotidi del campione. Un vero delirio di inaccettabile scienza
probabilistica, informatica, algoritmi e matematica creativa per presumere qualcosa che dovresti poter isolare
e sequenziare molto facilmente (se esiste). Nel caso del presunto CoV2 dai casi di Whuan hanno ottenuto la
prima sequenza di consenso attraverso primers "annidati", basandosi sulle sequenze note della filogenetica
SARS umana e animale, di fatto hanno spinto una ipotesi, la loro, ad avverarsi, montando insieme il
frankenstein sintetico che più corrispondeva alla loro ipotesi. Questa è l'ultima cosa da fare se scopri un
presunto nuovo patogeno mortale dal potenziale "pandemico". L'unica cosa giusta per un patogeno
sconosciuto di questo tipo è l'isolamento puro fisico-chimico della particella virale reale e integra. Qui NON
c'è nessun isolato men che meno "purificato", il che è GRAVISSIMO, questa è la solita brodaglia impura,

ossia "campionato" di Host o da Stock, 'chiarificato' e amplificato su cellule renali di scimmia immortalate,
cellule che dopo oltre 30 anni di clonaggio in lab sono praticamente tessuto sintetico, questa è la brodaglia
messa in stock e distribuita ai laboratori anche dal BEI. E loro preparavano queste sequenze dal
2008....dove vi sono le sequenze del cov3 addirittura o varianti o come le si voglia chiamare...Nessun virus
ha mai soddisfatto i Postulati di Koch per la determinazione di un patogeno. per farceli entrare, li riformulò
Alfred Evans nel 1976, ma fallì anch'egli e poi 20 anni dopo ci hanno provato due biologi americani,
Frederiks e Rahlman, facendoli diventare ben 14 e esprimendosi sempre in termini probabilistici..𝐄𝐄' 𝐬𝐬𝐬𝐬
𝐪𝐪𝐪𝐪𝐪𝐪𝐪𝐪𝐪𝐪𝐪𝐪 𝐛𝐛𝐛𝐛𝐛𝐛𝐛𝐛 𝐜𝐜𝐜𝐜𝐜𝐜 𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬 𝐫𝐫𝐫𝐫𝐫𝐫𝐫𝐫𝐫𝐫𝐫𝐫𝐫𝐫𝐫𝐫𝐫𝐫𝐫𝐫 𝐢𝐢𝐢𝐢 𝐦𝐦𝐦𝐦𝐦𝐦𝐦𝐦𝐦𝐦, 𝐧𝐧𝐧𝐧𝐧𝐧 𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬 𝐞𝐞̀ 𝐢𝐢𝐢𝐢𝐢𝐢𝐢𝐢𝐢𝐢𝐢𝐢𝐢𝐢𝐢𝐢 𝐢𝐢𝐢𝐢 𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬 𝐝𝐝𝐝𝐝𝐝𝐝𝐝𝐝𝐝𝐝 𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬 𝐞𝐞 𝐝𝐝𝐝𝐝𝐝𝐝𝐝𝐝𝐝𝐝
𝐩𝐩𝐩𝐩𝐩𝐩𝐩𝐩𝐩𝐩𝐩𝐩𝐩𝐩𝐩𝐩, 𝐪𝐪𝐪𝐪𝐪𝐪 𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬𝐬 𝐦𝐦𝐦𝐦𝐦𝐦𝐦𝐦𝐦𝐦 𝐨𝐨𝐨𝐨𝐨𝐨𝐨𝐨𝐨𝐨, 𝐪𝐪𝐪𝐪𝐪𝐪𝐪𝐪𝐪𝐪𝐪𝐪 𝐞𝐞̀ 𝐮𝐮𝐮𝐮 𝐯𝐯𝐯𝐯𝐯𝐯𝐯𝐯 𝐜𝐜𝐜𝐜𝐜𝐜𝐜𝐜𝐜𝐜𝐜𝐜𝐜𝐜 𝐜𝐜𝐜𝐜𝐜𝐜𝐜𝐜𝐜𝐜𝐜𝐜 𝐥𝐥'𝐮𝐮𝐮𝐮𝐮𝐮𝐮𝐮𝐮𝐮𝐮𝐮𝐮𝐮̀.

https://www.facebook.com/Max.Serapioni/posts/552336709034873
https://www.facebook.com/Max.Serapioni/posts/553992955535915
https://www.facebook.com/Max.Serapioni/posts/554031688865375
https://www.facebook.com/Max.Serapioni/posts/553963175538893
https://www.facebook.com/Max.Serapioni/posts/551787862423091
https://www.facebook.com/Max.Serapioni/posts/553955605539650

https://www.facebook.com/serapioni.massimo/posts/10219889629014866



Parole chiave correlate