File PDF .it

Condividi facilmente i tuoi documenti PDF con i tuoi contatti, il Web e i Social network.

Inviare un file File manager Cassetta degli attrezzi Ricerca PDF Assistenza Contattaci



postdeipost.pdf


Anteprima del file PDF postdeipost.pdf

Pagina 1 2 3 4 5 6 7 8

Anteprima testo


Protocollo China CDC: utilizza i geni ORF1ab e N come target.
Protocollo dell'Istituto Pasteur (Francia): utilizza due frammenti del RdRP (che dovrebbe essere specifico per
SARS.CoV-2).
Protocollo CDC degli Stati Uniti: utilizza tre frammenti del gene N.
Protocollo dell'Istituto Nazionale delle Malattie Infettive del Giappone: è l'unico che ha come bersaglio il gene
S insieme ad altri geni presumibilmente condivisi con altri coronavirus.
Protocollo Charite (Germania): utilizza i geni E, N e RdRP. - Protocollo dell'Università di Hong Kong: utilizza
ORF1b-nsp14 e il gene N.
Protocollo del National Institute of Health Thailand: utilizza il gene N.
Abbiamo quindi introdotto la sequenza dei primer - quella indica l'inizio della sequenza da rilevare (in avanti)
e quella che indica la finale (inversa) - nel BLAST in modo che possa ricercarli in due database: a raccolta
dei genomi microbici e quella corrispondente al genoma umano.
LE SEQUENZE DEL COSIDDETTO SARS-COV-2 SI TROVANO SIA NEGLI UMANI CHE IN NUMEROSI
MICROBI!
Vediamo nel dettaglio la procedura prendendo come esempio gli iniziatori del protocollo francese. Una volta
sul sito web BLAST , abbiamo scelto Microbes per cercare nel database del genoma microbico e siamo
passati alla pagina successiva. Quindi è apparso un modulo in cui abbiamo inserito la sequenza
dell'iniziatore in avanti del protocollo francese -che è ATGAGCTTAGTCCTGTG -, abbiamo selezionato le
sequenze molto simili e abbiamo premuto il tasto BLAST . Pochi secondi dopo sono comparsi i risultati abbiamo fatto uno screenshot ( immagine 1 ) - e ci sono state mostrate 100 sequenze di microbi- in
particolare batteri e archeobatteri - con una coincidenza tra il 77% e il 100% con una percentuale di identità
del 100%.
Siamo quindi tornati alla home page e la seconda volta che abbiamo scelto Human per la ricerca nel
genoma umano, abbiamo ripetuto la stessa operazione e dopo pochi secondi è apparso il risultato che
abbiamo catturato nuovo (immagine 2). E si scopre che la sequenza inserita coincide con 74 sequenze del
genoma umano , con una coincidenza compresa tra il 66% e il 100% e una percentuale di identità del 100%.
E questo indica che la sequenza di quel primer PCR iniziale che dovrebbe essere specifico per SARS-CoV-2
corrisponde in realtà a 74 frammenti del genoma umano e anche a cento frammenti microbici !
Abbiamo quindi deciso di ripetere l'operazione ma con il primer finale o inverso - che è
CTCCCTTTGTGTGTGT - ei risultati sono stati simili.
Trattandosi di sequenze molto brevi -una ventina di lettere genetiche o nucleotidi- abbiamo deciso di
riprovare ma con la sequenza target definita da questi due primer, ovvero la sequenza del presunto genoma
SARS-CoV-2 che si trova tra il primer iniziale e il primer finale . Ovviamente, per questo c'era bisogno della
sequenza che è dichiarata essere il "genoma SARS-CoV-2" e sebbene migliaia di laboratori affermino di
averlo isolato e sequenziato -una falsa affermazione come abbiamo spiegato in precedenti rapporti- abbiamo
deciso di farlo vai al sito web
https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2?+report=genbank&to=29903
del Centro nazionale per l'informazione sulle biotecnologie : Una volta lì, abbiamo localizzato la "sequenza
target", un frammento di 108 nucleotidi localizzato tra le posizioni 12.690 e 12.797 del "genoma", che è
questo:
ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACACAAACTGCTTGCACTGAT
GACAATGCGTTAGCTTACAACAACAAAGGGAG .
Con questo abbiamo ripetuto i passaggi precedentemente definiti i risultati sono stati ancora una volta
sorprendenti poiché sono apparse nuovamente un centinaio di sequenze microbiche con una percentuale di
corrispondenza del 100% e quattro sequenze del genoma umano con una percentuale di identità compresa
tra 83% e 95 % . Le corrispondenze sono state quindi inferiori ma l'importante è che continuiamo a trovare
frammenti della presunta "sequenza bersaglio" di SARS-CoV-2 sia nei microbi che nel nostro stesso genoma
.