File PDF .it

Condividi facilmente i tuoi documenti PDF con i tuoi contatti, il Web e i Social network.

Inviare un file File manager Cassetta degli attrezzi Ricerca PDF Assistenza Contattaci



postdeipost.pdf


Anteprima del file PDF postdeipost.pdf

Pagina 1 2 3 4 5 6 7 8

Anteprima testo


Veramente stupito ABBIAMO Fatto un Ulteriore passo e testati con il gene considerato un quel tempo
Venuto il Più SPECIFICO di SARS-CoV-2, il gene E che dovrebbe Generare le proteine dell'involucro e si
TROVA Tra le POSIZIONI 26,245 e 26.472:
ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTTAATAGCGTACTTCTCTTGCTTTCGT
GGTATTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTGTTAACGTGAG
TCTTGTAAAACCTTTACGTTTACTCGTGTTAAAATCTGAATTCTTCTAGAGTTCG ATTCTGGTCTAA .
Abbiamo ripetuto con esso i passaggi già e il risultato è stato ancora più sorprendente perché nonostante la
sua lunghezza sono apparse altre cento sequenze microbiche con una percentuale di identità del 100% e 10
sequenze del genoma umano con una percentuale di identità compresa tra l '80 % e il 100%. E risultati simili
sono stati ottenuti con un frammento scelto un caso e con il gene N che si dice corrisponda alle proteine del
nucleocapside SARS-CoV-2 .
Alla fine abbiamo deciso di testare con il gene S che si dice generi le proteine "spike" strutturali che sono
fondamentali per l'ingresso nella cellula e che successivamente è stato considerato il gene SARSCoV-2 più
specifico. Poiché si tratta di un gene la cui sequenza è molto più lunga - 3821 nucleotidi tra le posizioni
21,563 e 25,384 - abbiamo testato con due frammenti scelti a caso all'interno di quel gene e il primo TTGGCAAAATTCAAGACTCACTTTC - ha prodotto un altro centinaio di sequenze di microbi e 93 sequenze
del genoma umano e il secondo - CTTGCTGCTACTAAATGCAGAGTGT - un centinaio di sequenze
microbiche e 90 del genoma umano.
Alla fine abbiamo deciso di testare con gli iniziatori del Japan Protocol, l'unico che include sequenze target
del gene S e, il lettore ha già intuito, i risultati sono stati ancora una volta simili: un centinaio di sequenze di
microbi e 93 sequenze di genoma umano con una percentuale di identità compresa tra il 94,12% e il 100% !
CONCLUSIONI
La conseguenza di tutto ciò che abbiamo appena spiegato è chiara e immediata: NON ESISTE TEST
VALIDO PER RILEVARE SARS-COV-2 , né test anticorpali o antigene né RT-PCR. E abbiamo incluso quelli
sul presunto gene che codifica per la proteina S1 o spike. E questo significa che TUTTI I NUMERI DI "CASI",
"INFETTI", "MALATI", "Asintomatici" O "MORTI A CAUSA DI COVID-19" MANCANO DI UNA BASE
SCIENTIFICA E TUTTI I "POSITIVI" SONO FALSI POSITIVI , qualcosa che essere comunicato
immediatamente alle persone colpite ei responsabili dovrebbero essere ritenuti responsabili.
Concludiamo aggiungendo che anche la stessa OMS non crede veramente a questi test. Basta leggere il
documento pubblicato lo scorso 11 settembre come guida di laboratorio per SARS-CoV-2 intitolato Test
diagnostici per SARS-CoV-2 - è disponibile su https://apps.who.int/iris/rest/bitstreams/1302661/retrieve - e si
legge letteralmente a pagina 5: "Quando possibile, la sospetta infezione attiva dovrebbe essere testata con
un test di amplificazione degli acidi nucleici (NAAT) come RT-PCR. I test NAAT dovrebbero mirare al
genoma di SARS-CoV-2 ma poiché c'è nessuna circolazione globale nota di SARS-CoV-1 una sequenza di
Sarbecovirus (che si presume includa almeno cinque coronavirus umani e animali tra cui SARS-CoV-1 e
SARS-Cov-2) è anche un obiettivo ragionevole ". Questo è, L'OMS accetta di utilizzare sequenze non
specifiche per rilevare SARS-CoV-2 .
Non è tutto perché il manuale successivamente afferma: " Una diagnosi ottimale consiste in un test NAAT
con almeno due bersagli indipendenti dal genoma del SARS-CoV-2; tuttavia, nelle aree in cui la trasmissione
è diffusa, un semplice algoritmo a bersaglio singolo può essere utilizzato . "
Il manuale dell'OMS afferma: " Uno o più risultati negativi non escludono necessariamente l'infezione da
SARSCoV-2 . Ci sono una serie di fattori che possono produrre un risultato negativo in un individuo infetto,
inclusa la scarsa qualità del campione, la raccolta tardiva del campione, trattamento inadeguato, o ragioni
tecniche inerenti al test, come la mutazione del virus o l'inibizione della PCR. ”Cosa aspettano i giudici per
agire di propria iniziativa?